DESAIN PRIMER MMP-8 dan IL-6 UNTUK ANALISIS EKSPRESI GEN JARINGAN GUSI Rattus norvegicus DENGAN qRT-PCR

Yasmine Dwinda; Muhammad Farikh; Vraya Tiranissa; Windi Yunita Sari; Bintang Fadhil Ramadhan; Siska Alicia Farma

doi:10.36526/biosense.v9i1.7222

Authors

Yasmine Dwinda Universitas Negeri Padang
Muhammad Farikh Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang
Vraya Tiranissa Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang
Windi Yunita Sari Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang
Bintang Fadhil Ramadhan Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang
Siska Alicia Farma Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Padang

DOI:

https://doi.org/10.36526/biosense.v9i1.7222

Keywords:

MMP-8, IL-6, qRT-PCR, Rattus norvegicus, design primer

Abstract

Matrix Metalloproteinase 8 (MMP-8) and Interleukin 6 (IL-6) are two important genes that mediate inflammation and play a role in inflammatory cases. This study aims to design two specific primer candidates for testing gene expression using the qRT-PCR method in Rattus norvegicus experiencing inflammation and gingivitis. Primer design was performed using Geneious Prime software and BLAST primers to determine primer quality through PCR product size, primer length, melting temperature (Tm), and %GC, as well as to ensure that the resulting primers only bind to the Rattus norvegicus genome target. The results showed that the size of the MMP-8 forward product CGGGGTATTGGAGGAGATGC; reverse CAGGGTTGTCTGAAGGTCCATA was 241 bp with a primer length of 20-22 nucleotides, %GC between 50-60%, and Tm not more than 60°C, and the size of the IL-6 product forward AGAGACTTCCAGCCAGTTGC; reverse TGCCATTGCACAACTCTTTTC is 199 bp with a primer length of 20-21 nucleotides, %GC between 42.86-55% and Tm not more than 60°C. BLAST primer results indicate that both primer pairs are specific and suitable as candidate primers for qRT-PCR testing in studies of inflammation-related gene expression and gingival inflammation.

References

Bustin, S., & Huggett, J. (2017). Review Article : qPCR primer design revisited. Biomolecular Detection and Quantification, 14(March), 19–28. https://doi.org/10.1016/j.bdq.2017.11.001

Cindrayani, S., Sukmana, D. J., Hadiatun, N., & Aini. (2023). Literature Review : Hubungan dan Peranan Interleukin-6 ( Il-6 ) pada Penderita COVID-19 ( Literature Review : Relationship and Role of Interleukin-6 ( IL-6 ) in. 1(3), 76–80.

Fratiwi, N., Saranani, S., Agastia, G., & Isrul, M. (2022). Aktivitas Antiinflamasi Ekstrak Etanol Daun Kirinyuh ( Chromolaena odorata L .) dan Pengaruhnya Terhadap Kadar Interleukin 6 ( IL-6 ) Pada Tikus Jantan Galur Wistar Anti-inflammatory Activities of Kirinyuh ( chromolaena odorata L .) Leaf Ethanol Extract a. 1(2).

Ilmi, A. N., Pujiyanti, A. S., & Amirullah. (2025). Desain Primer Secara in Silico untuk Amplifikasi Gen TGF- β 1 dan TNF- α pada Mencit Mus Musculus Sebagai Kandidat Primer dalam Uji qRT-PCR. 12(1), 118–128.

Indriani, L., Dharmautama, M., Machmud, E., Djide, M., & Hatta, M. (2018). Perubahan rasio ekspresi mRNA MMP-8 / TIMP- 1 setelah aplikasi gel ekstrak bunga rosella 10 % pada pasien dengan gingivitis setelah pemasangan mahkota tiruan akrilik. 2(7), 56–61.

Isromi, T., Winahyu, D., & Tutik. (2023). Uji Efektivitas Ekstrak Kulit Petai (Parkia Speciosa) Sebagai Antiinflamasi Terhadap Tikus Putih (Rattus Novergicus) Jantan Galur Wistar Yang Di Induksi Karagenan. 10(3), 1605–1614.

Malaha, N., Sartika, D., Pannyiwi, R., Zaenal, & Zakiah, V. (2023). Efektifitas Sediaan Biospray Revolutik Dalam Menurunkan Jumlah Pmn L Dalam Proses Penyembuhan Luka. 2, 145–152.

Meilawaty, Z., Shita, A., Kuncaraningtyas, P., Dharmayanti, A., & Hamzah, Z. (2020). Potensi ekstrak daun singkong (Manihot esculenta Crantz) terhadap ekspresi MMP-8 fibroblas gingiva pada model tikus dengan disfungsi ovarium dan periodontitis Zahara. 105–112. https://doi.org/10.24198/jkg.v32i2.27466

Putra, I. G. E. P., Ulfah, M., Nurhayati, N., & Helianti, I. (2024). Coproduction of alkaline protease and xylanase from genetically modified Indonesian local Bacillus halodurans CM1 using corncob as an inducing substrate. Saudi Journal of Biological Sciences, 31(4), 103947. https://doi.org/10.1016/j.sjbs.2024.103947